Metabolic engineering of a genetic selection system with tunable stringency

Kleeb et al. 10.1073/pnas.0705379104.

Supporting Information

Files in this Data Supplement:

SI Text




SI Text

Construction of Plasmids. pAKZ1 (3,403 bp) was constructed by ligating a PCR product encoding the cyclohexadienyl dehydrogenase (TyrC) from Zymomonas mobilis with the 2,507-bp Bsp120I-BspHI fragment of the vector pKIMP-UAUC (1). The PCR was carried out with chromosomal DNA as template using primers Zm-CDH-for1 (5'-CGCTCTTCATGACCGTCTTTAAGC) and Zm-CDH-rev1 (5'-ACGGCTGGGCCCGCGGCCTTAATTTTAAGGGTGAA) (restriction sites used for cloning underlined).

pAKZ3-EcCM (4,849 bp) is a ligation product of the 4,561-bp NdeI-XhoI fragment of pMG211 (2) and the 288-bp XhoI-NdeI fragment of pET-EcCM (3).

pAKZ4 (4,690 bp) is related to pMG211 (2) but contains a silent mutation in the bla gene that eliminates a BsaI site. It was constructed by using the Stratagene QuikChange mutagenesis protocol with the primers (mutation underlined) rm_BsaI_for (5'-TGCAATGATACCGCGTGACCCACGCTCACCG) and rm_BsaI_rev (5'-CGGTGAGCGTGGGTCACGCGGTATCATTGCA) and subsequent subcloning of the BspHI-PstI fragment (414 bp) to replace the corresponding fragment in pMG211.

pAKZ6 (5,899 bp) was constructed by PCR amplification of a 1,409-bp fragment of pAKZ1 by using primer pAKZ6_stuff_for (5'-GGACTAGTCATTATTAGTGGTGAGACCATCTGCATCGCAGGATGCTGCT; SpeI site underlined and BsaI site in bold), and primer pAKZ6_stuff_rev (5'-CCCCTCTAGAAATAATTTTGTTGAACTGAGACCCGTTACGCACCACCCCG; XbaI site underlined and BsaI site in bold), digestion with SpeI and XbaI, and ligation to the 4,490-bp SpeI-XbaI fragment of pAKZ4.

pAKZ7 (5,161 bp), which harbors the gene for WT EcPDT, is a ligation product of the 4,520-bp BsaI-BsaI fragment of pAKZ6 and the BsaI-digested PCR product that codes for residues 101-300 of the P-protein (PheA) from Escherichia coli. The PCR product was obtained by using EcPDT_N (5'-GTAGGACGGGTCTCTGAACTTTAAGAAGGAGATATACATATGCCGCACTCAGCACGC) and EcPDT_C_His (5'-GTAGGACGGGTCTCAGTGGTGGTGGTGGTGGTGCAACGTGGTTTTCGCCG) as primers (BsaI sites are underlined) and pKB663 (4) as template. The W226A and N160A variants of EcPDT were produced from plasmids pAKZ7-W226A and pAKZ7-N160A, respectively. These plasmids (both 5,161 bp) were derived from pAKZ7 by using the Stratagene QuikChange mutagenesis protocol with primer pairs W226A_for (5'-CGGTATATTCAATCTTCGCGTGCGGATAACGATT) and W226A_rev (5'-AATCGTTATCCGCACGCGAAGATTGAATATACCG), and N160A_for (5'-GGCACCGGAGCTGGTCGCTTCAATCGGTACGACG) and N160A_rev (5'-CGTCGTACCGATTGAAGCGACCAGCTCCGGTGCC), respectively.

pAKZ13 (5,389 bp) was constructed as the PCR template for library assembly and corresponds to pAKZ11 (5), except that the encoded MjPDT is extended at its N terminus by a Met(His)6(GlySer)2 tag. It was assembled by PCR-amplifying the M. jannaschii pheA gene by using the template pAKZ11 and primers (restriction sites are underlined) MjPDT_His_N-Term (5'-GGGAATTCCATATGCACCATCACCATCACCATGGTTCTGGATCCATGAATAAAGCAGTTATTTATACATTACCAAAAG) and MjPDT_C-Term (5'-GGACTAGTCATTATTAATCAAAAACTGGGTATTTTCCTAAAAG), and ligating the 860-bp NdeI-SpeI fragment of the PCR product to the 4,529-bp NdeI-SpeI fragment of pMG211 (2).

pDpheA is similar to pMG207 (6), except that the two dsbA1 and dsbA2 regions in pMG207 were replaced by two segments flanking chromosomal pheA from E. coli. pDpheA (10,401 bp) was constructed by a four-way ligation of the following fragments: The 5,119-bp acceptor fragment, including the origin of replication, the pheS (G294) gene, the bla gene, and the recA gene, was obtained by digestion of pMG207 with XbaI and SacII (and EagI) and subsequent gel purification. Plasmid pMG207 was also digested with EagI and EcoRI, and the 1,208-bp fragment encoding the kanamycin resistance gene was gel-purified. The two DNA fragments pheA1 and pheA2 flanking the chromosomal pheA gene were amplified by PCR using chromosomal DNA from E. coli strain AD494 (7) as template. To generate pheA1, a 2,035-bp fragment was assembled with primers 179-EPHEA1-5' (5'-CTTCCTCTAGATTCGACTAAACGCGTCTGA) and 180-EPHEA1-3' (5'-GACAACCGGCCGCAAAAAACGCGCCCGAAG). Then, this PCR product was digested with XbaI and EagI, and the 2,018-bp fragment was gel-purified. To assemble pheA2, a 2,071-bp fragment was generated by using primers 181-EPHEA2-5' (5'-GATGAATTCGGCCGTTGATCCAACCTGATGAAA) and 182-EPHEA2-3' (5'-GCCGACCCGCGGAATATGCTCGTCGATTT). Digestion of the pheA2 PCR product by EcoRI and SacII yielded a 2,056-bp fragment that was gel-purified.

pMHEtetCDH (4,117 bp) was constructed by replacing the UV5 lac promoter upstream of tyrC in pAKZ1 with the tetracycline promoter system from pMG-Ptet-GFP (8). The tetracycline promoter and the tetR repressor gene were amplified by PCR using primers forclaI (5'-CCATCGATCTTAAGACCCACTTTCACATTTAAG) and revbsphI (5'-TTGTTGTCATGATATATCTCCTTCTTAAAGTTAAACAAAATTA), followed by digestion with ClaI and BspHI and ligation of the 796-bp fragment with the 3,321-bp ClaI-BspHI fragment of pAKZ1.

1. Kast P, Asif-Ullah M, Jiang N, Hilvert D (1996) Proc Natl Acad Sci USA 93:5043-5048.

2. Sasso S, Ramakrishnan C, Gamper M, Hilvert D, Kast P (2005) FEBS J 272:375-389.

3. MacBeath G, Kast P, Hilvert D (1998) Biochemistry 37:10062-10073.

4. Maruya A, O'Connor MJ, Backman K (1987) J Bacteriol 169:4852-4853.

5. Kleeb AC, Kast P, Hilvert D (2006) Biochemistry 45:14101-14110, erratum (2007) 46:2552-2552.

6. Gamper M, Kast P (2005) Biotechniques 38:405-408.

7. Prinz WA, Aslund F, Holmgren A, Beckwith J (1997) J Biol Chem 272:15661-15667.

8. Neuenschwander M (2006) Ph.D. thesis (Eidgenössiche Technische Hochschule, Zurich).

This Article

  1. PNAS August 28, 2007 vol. 104 no. 35 13907-13912